Review



fstl4 shrna constructs  (Genechem)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Genechem fstl4 shrna constructs
    Fstl4 Shrna Constructs, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/constructs+shrna/pm42310642-69-5-8
    Average 86 stars, based on 1 article reviews
    fstl4 shrna constructs - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Knockdown:

    Article Title: CRISPR/Cas9-based genome-wide screening for metastasis ability identifies FCGR1A regulating the metastatic process of ovarian cancer by targeting LSP1
    Article Snippet: .. To knock down FCGR1A, three short hairpin RNA (shRNA) constructs, FCGR3A-sh-a (5′-GGTCATGAGAAGAAGGTAA-3′), FCGR3A-sh-b (5′-CCCTGAGTTGGAGCTTCAA-3′), and FCGR3A-sh-c (5′- CTCTGAATACCAAATACTA-3′), and a scrambled NC shRNA (5′-CTAAGGTTAAGTCGCCCTC-3′) were chemically synthesized at GeneChem (Shanghai, China). .. The shRNA sequences were synthesized, cloned and inserted into recombinant shRNA expression vectors using Lipofectamine 2000 (Invitrogen).

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    shRNA:

    Article Title: CRISPR/Cas9-based genome-wide screening for metastasis ability identifies FCGR1A regulating the metastatic process of ovarian cancer by targeting LSP1
    Article Snippet: .. To knock down FCGR1A, three short hairpin RNA (shRNA) constructs, FCGR3A-sh-a (5′-GGTCATGAGAAGAAGGTAA-3′), FCGR3A-sh-b (5′-CCCTGAGTTGGAGCTTCAA-3′), and FCGR3A-sh-c (5′- CTCTGAATACCAAATACTA-3′), and a scrambled NC shRNA (5′-CTAAGGTTAAGTCGCCCTC-3′) were chemically synthesized at GeneChem (Shanghai, China). .. The shRNA sequences were synthesized, cloned and inserted into recombinant shRNA expression vectors using Lipofectamine 2000 (Invitrogen).

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Article Title: RAD21 Drives Tumor Progression and Confers Anti-PD-1 Resistance by Reprogramming Tumor-Associated Macrophages via Upregulation of CSF1 Signaling.
    Article Snippet: 46 Immune checkpoint inhibitors (ICIs) have revolutionized cancer therapy; however, 47 primary and acquired resistance, driven largely by tumor cell‐mediated remodeling of 48 the immunosuppressive tumor microenvironment (TME), limits durable responses in 49 most patients.. The cohesin subunit RAD21 exhibits frequent copy number variation 50 (CNV) across human cancers, yet its role in modulating tumor immunity remains poorly 51 defined.. Here, we identify RAD21 as a frequently amplified oncogene that promotes 52 tumor cell proliferation and metastasis and whose elevated expression correlates with 53 poor patient survival.

    Article Title: Growth Differentiation Factor 11 Attenuates Photoaging through Ferroptosis Pathway in SZ95 Sebocytes.
    Article Snippet: Address correspondence to Zhibo Xiao, Department of Plastic and Aesthetic Surgery, Second Affiliated Hospital of Harbin Medical University Q6 , Harbin, 150086, China.. E-mail: xiaozhibodoctor@126. com.. Sebaceous glands synthesize and secrete sebum, forming a protective barrier on the skin.

    Article Title: CSN6 and Rab34 Are Involved in Androgen Receptor Trafficking in Mouse Testicular Sertoli Cells.
    Article Snippet: Materials and Methods Reagents and constructs Unless other indicated, all the chemical reagents were obtained from Sigma-Aldrich (USA) and all cell culture reagents were bought from Life Technologies (USA). .. The shRNA constructs were provided by Shanghai Genechem Co., Ltd. (China). ..

    Article Title: RGS20 reduces glioma stemness and temozolomide resistance by intrinsically inhibiting the WNT/β-catenin signaling pathway.
    Article Snippet: .. 111 112 Lentiviral transfection: 113 Lentiviral shRNA constructs were obtained from Genechem (China). shRNA sequences were as 114 follows: GAGAAATCTATTGAAGCAT, shRGS20-1; TCGTGTCTCACTGTTAGAA, shRGS20-2. ..

    Article Title: Dissecting the heterogeneity of the alternative polyadenylation profiles in triple-negative breast cancers
    Article Snippet: .. All shRNA constructs were purchased from Genechem (Genechem Co., Shanghai, China). ..

    Construct:

    Article Title: CRISPR/Cas9-based genome-wide screening for metastasis ability identifies FCGR1A regulating the metastatic process of ovarian cancer by targeting LSP1
    Article Snippet: .. To knock down FCGR1A, three short hairpin RNA (shRNA) constructs, FCGR3A-sh-a (5′-GGTCATGAGAAGAAGGTAA-3′), FCGR3A-sh-b (5′-CCCTGAGTTGGAGCTTCAA-3′), and FCGR3A-sh-c (5′- CTCTGAATACCAAATACTA-3′), and a scrambled NC shRNA (5′-CTAAGGTTAAGTCGCCCTC-3′) were chemically synthesized at GeneChem (Shanghai, China). .. The shRNA sequences were synthesized, cloned and inserted into recombinant shRNA expression vectors using Lipofectamine 2000 (Invitrogen).

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Article Title: RAD21 Drives Tumor Progression and Confers Anti-PD-1 Resistance by Reprogramming Tumor-Associated Macrophages via Upregulation of CSF1 Signaling.
    Article Snippet: 46 Immune checkpoint inhibitors (ICIs) have revolutionized cancer therapy; however, 47 primary and acquired resistance, driven largely by tumor cell‐mediated remodeling of 48 the immunosuppressive tumor microenvironment (TME), limits durable responses in 49 most patients.. The cohesin subunit RAD21 exhibits frequent copy number variation 50 (CNV) across human cancers, yet its role in modulating tumor immunity remains poorly 51 defined.. Here, we identify RAD21 as a frequently amplified oncogene that promotes 52 tumor cell proliferation and metastasis and whose elevated expression correlates with 53 poor patient survival.

    Article Title: Growth Differentiation Factor 11 Attenuates Photoaging through Ferroptosis Pathway in SZ95 Sebocytes.
    Article Snippet: Address correspondence to Zhibo Xiao, Department of Plastic and Aesthetic Surgery, Second Affiliated Hospital of Harbin Medical University Q6 , Harbin, 150086, China.. E-mail: xiaozhibodoctor@126. com.. Sebaceous glands synthesize and secrete sebum, forming a protective barrier on the skin.

    Article Title: CSN6 and Rab34 Are Involved in Androgen Receptor Trafficking in Mouse Testicular Sertoli Cells.
    Article Snippet: Materials and Methods Reagents and constructs Unless other indicated, all the chemical reagents were obtained from Sigma-Aldrich (USA) and all cell culture reagents were bought from Life Technologies (USA). .. The shRNA constructs were provided by Shanghai Genechem Co., Ltd. (China). ..

    Article Title: RGS20 reduces glioma stemness and temozolomide resistance by intrinsically inhibiting the WNT/β-catenin signaling pathway.
    Article Snippet: .. 111 112 Lentiviral transfection: 113 Lentiviral shRNA constructs were obtained from Genechem (China). shRNA sequences were as 114 follows: GAGAAATCTATTGAAGCAT, shRGS20-1; TCGTGTCTCACTGTTAGAA, shRGS20-2. ..

    Article Title: Dissecting the heterogeneity of the alternative polyadenylation profiles in triple-negative breast cancers
    Article Snippet: .. All shRNA constructs were purchased from Genechem (Genechem Co., Shanghai, China). ..

    Synthesized:

    Article Title: CRISPR/Cas9-based genome-wide screening for metastasis ability identifies FCGR1A regulating the metastatic process of ovarian cancer by targeting LSP1
    Article Snippet: .. To knock down FCGR1A, three short hairpin RNA (shRNA) constructs, FCGR3A-sh-a (5′-GGTCATGAGAAGAAGGTAA-3′), FCGR3A-sh-b (5′-CCCTGAGTTGGAGCTTCAA-3′), and FCGR3A-sh-c (5′- CTCTGAATACCAAATACTA-3′), and a scrambled NC shRNA (5′-CTAAGGTTAAGTCGCCCTC-3′) were chemically synthesized at GeneChem (Shanghai, China). .. The shRNA sequences were synthesized, cloned and inserted into recombinant shRNA expression vectors using Lipofectamine 2000 (Invitrogen).

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Article Title: Growth Differentiation Factor 11 Attenuates Photoaging through Ferroptosis Pathway in SZ95 Sebocytes.
    Article Snippet: Address correspondence to Zhibo Xiao, Department of Plastic and Aesthetic Surgery, Second Affiliated Hospital of Harbin Medical University Q6 , Harbin, 150086, China.. E-mail: xiaozhibodoctor@126. com.. Sebaceous glands synthesize and secrete sebum, forming a protective barrier on the skin.

    Clone Assay:

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Recombinant:

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Expressing:

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. Lentivirus construction To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors.

    Article Title: Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer
    Article Snippet: .. To knockdown ST3GAL1, three short hairpin RNA (shRNA) constructs: ST3GAL1-shRNA1# (5′- TAAGAAGACTCCCTCAGGTTG-3′) and ST3GAL1-shRNA2# (5′-AACATCAGCTTCAAACCCTGC-3′), and ST3GAL1-shRNA3# (5′- TTGAGAAGATGACCGAGAGGA-3′) and a scrambled NC shRNA (scr, 5′- GACCTGTACGCCAACACAGTG -3′) were chemically synthesized at Genechem (Shanghai, China), the shRNA sequences were synthesized and cloned into recombinant shRNA expression vectors. .. The shRNAs were cloned into the PLKO.1-puro recombinant shRNA expression vector (Invitrogen) and co-transfected with the lentiviral packaging helper plasmids, pCMV-dR8.91 and envelope VSV-G (Addgen, Cambridge, MA, USA) into 293 T cells using Lipofectamine 2000 (Invitrogen).

    Transfection:

    Article Title: RGS20 reduces glioma stemness and temozolomide resistance by intrinsically inhibiting the WNT/β-catenin signaling pathway.
    Article Snippet: .. 111 112 Lentiviral transfection: 113 Lentiviral shRNA constructs were obtained from Genechem (China). shRNA sequences were as 114 follows: GAGAAATCTATTGAAGCAT, shRGS20-1; TCGTGTCTCACTGTTAGAA, shRGS20-2. ..



    Similar Products

    small interfering rna sirna constructs targeting igf2bp3  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology small interfering rna sirna constructs targeting igf2bp3
    Small Interfering Rna Sirna Constructs Targeting Igf2bp3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/IGF2BP3+shRNA+Plasmid/pm42833600-130-24-34
    Average 90 stars, based on 1 article reviews
    small interfering rna sirna constructs targeting igf2bp3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    lentiviral plko 1 shrna construct shgfp  (Addgene inc)
    94
    Addgene inc lentiviral plko 1 shrna construct shgfp
    Lentiviral Plko 1 Shrna Construct Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/pLKO%2E1+puro+GFP+siRNA+(Plasmid+%2312273)/10__1158_slash_0008___5472__can___26___1063-43-1-6
    Average 94 stars, based on 1 article reviews
    lentiviral plko 1 shrna construct shgfp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    lentiviral pxdn shrna knockdown constructs  (OriGene)
    94
    OriGene lentiviral pxdn shrna knockdown constructs
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Lentiviral Pxdn Shrna Knockdown Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/Pxdn+Mouse+shRNA+Lentiviral+Particle/pmc13253085-386-0-16
    Average 94 stars, based on 1 article reviews
    lentiviral pxdn shrna knockdown constructs - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fstl4 shrna constructs  (Genechem)
    86
    Genechem fstl4 shrna constructs
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Fstl4 Shrna Constructs, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/constructs+shrna/pm42310642-69-5-8
    Average 86 stars, based on 1 article reviews
    fstl4 shrna constructs - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    shrna constructs targeting znf217  (System Biosciences Inc)
    86
    System Biosciences Inc shrna constructs targeting znf217
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Shrna Constructs Targeting Znf217, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/against+encoding+ir+lentiviral+sequence+shrna+targeting+%CE%B2/pm42288668-56-22-32
    Average 86 stars, based on 1 article reviews
    shrna constructs targeting znf217 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    lentiviral shrna constructs targeting aurka shaurka  (Genechem)
    86
    Genechem lentiviral shrna constructs targeting aurka shaurka
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Lentiviral Shrna Constructs Targeting Aurka Shaurka, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/constructs+shrna/pm42173301-62-11-24
    Average 86 stars, based on 1 article reviews
    lentiviral shrna constructs targeting aurka shaurka - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    sirna constructs targeting cend1  (Genechem)
    86
    Genechem sirna constructs targeting cend1
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Sirna Constructs Targeting Cend1, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/sequences+sirna/pm42251374-179-1-16
    Average 86 stars, based on 1 article reviews
    sirna constructs targeting cend1 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    dp103 shrna construct  (OriGene)
    94
    OriGene dp103 shrna construct
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Dp103 Shrna Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/Factor+XIIIa+(F13A1)+Rabbit+Polyclonal+Antibody/pm42248871-503-3-30
    Average 94 stars, based on 1 article reviews
    dp103 shrna construct - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    shrna constructs  (Genechem)
    86
    Genechem shrna constructs
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Shrna Constructs, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/constructs+shrna/pm42140344-56-9-15
    Average 86 stars, based on 1 article reviews
    shrna constructs - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    stable cell line generation lentiviral shrna constructs targeting cfb sh cfb  (Ubigene Biosciences Co Ltd)
    86
    Ubigene Biosciences Co Ltd stable cell line generation lentiviral shrna constructs targeting cfb sh cfb
    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of <t>PXDN</t> in each sample (cluster 3) is highlighted in red.
    Stable Cell Line Generation Lentiviral Shrna Constructs Targeting Cfb Sh Cfb, supplied by Ubigene Biosciences Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shrna+constructs/anxa6+cell+line+sh+siha+stable/pm42115715-94-3-20
    Average 86 stars, based on 1 article reviews
    stable cell line generation lentiviral shrna constructs targeting cfb sh cfb - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of PXDN in each sample (cluster 3) is highlighted in red.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Significantly differentially expressed ECM molecules in early, mid and late-stage mammary tumor samples from the PyMT mouse model of breast cancer in comparison to healthy fat pad tissue (A) PCA of individual samples ( n = 4 or 5 mice per group). Principal components 1 and 2 account for 81.6% of the variability in the dataset. (B) Heatmap of significantly differentially deposited matrisomal elements between groups within the dataset (left). Missing values are shaded in gray. Four major clusters were identified based on Euclidian hierarchical clustering of proteins (middle) and the matrisome categorical annotation for these clustered matrisomal elements based on the matrisome project is shown (right). Expression of PXDN in each sample (cluster 3) is highlighted in red.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Comparison, Expressing

    Association of PXDN expression with patient overall survival Significance between Kaplan-Meier survival curves were calculated with the log-rank test. (A) Overall survival of 1,082 patients from the TCGA breast cancer cohort stratified by median mRNA expression of PXDN. (B) Overall survival of 1,082 patients from the TCGA breast cancer cohort separated by disease stage, and stratified by median mRNA expression of PXDN (dotted line = low PXDN expression, solid line = high PXDN expression) and stage of disease (stage I, red; II, gold; III, green; IV, blue; or unknown, purple). (C) Extraction of data from (B) showing patients with stage II breast cancer at the time of diagnosis stratified by median mRNA expression of PXDN (dotted line = low PXDN expression, solid line = high PXDN expression) ( n = 615). (D) Examples of PXDN IHC staining intensity and corresponding intensity scores for the stromal and epithelial compartments of tumors ( n = 334). Scale bars, 50 μm. (E) Overall survival of 311 invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by high vs. low Allred-scores for PXDN IHC staining of epithelial compartments of tumors. (F) Overall survival of 309 invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by high vs. low Allred-scores for PXDN IHC staining of stromal compartments of tumors. (G) Overall survival of invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by combined stromal and epithelial Allred-scores for PXDN IHC staining of cores. Log-rank p values between each curve of (G) are listed in .

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Association of PXDN expression with patient overall survival Significance between Kaplan-Meier survival curves were calculated with the log-rank test. (A) Overall survival of 1,082 patients from the TCGA breast cancer cohort stratified by median mRNA expression of PXDN. (B) Overall survival of 1,082 patients from the TCGA breast cancer cohort separated by disease stage, and stratified by median mRNA expression of PXDN (dotted line = low PXDN expression, solid line = high PXDN expression) and stage of disease (stage I, red; II, gold; III, green; IV, blue; or unknown, purple). (C) Extraction of data from (B) showing patients with stage II breast cancer at the time of diagnosis stratified by median mRNA expression of PXDN (dotted line = low PXDN expression, solid line = high PXDN expression) ( n = 615). (D) Examples of PXDN IHC staining intensity and corresponding intensity scores for the stromal and epithelial compartments of tumors ( n = 334). Scale bars, 50 μm. (E) Overall survival of 311 invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by high vs. low Allred-scores for PXDN IHC staining of epithelial compartments of tumors. (F) Overall survival of 309 invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by high vs. low Allred-scores for PXDN IHC staining of stromal compartments of tumors. (G) Overall survival of invasive ductal carcinoma patients from the CREA tumor microarray cohort stratified by combined stromal and epithelial Allred-scores for PXDN IHC staining of cores. Log-rank p values between each curve of (G) are listed in .

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Expressing, Extraction, Biomarker Discovery, Immunohistochemistry, Microarray

    Single cell analysis of breast tumor cells expressing PXDN (A–C) Murine PyMT tumor single cell data (11,490 cells) obtained from Valdés-Mora et al. (A) UMAP of the major cell types identified in the murine single cell data. (B) UMAP of PXDN expression across cells. (C) Violin plots of fold change in PXDN expression according to cell type in the murine dataset. (D and E) Human breast cancer single cell and spatial data containing 130,246 cells from 26 invasive breast cancer patients. (D) UMAP of the major cell types identified in the human single cell data. (E) UMAP of PXDN expression across human cells. (F) Boxplots of fold change in PXDN expression according to cell type in the human dataset.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Single cell analysis of breast tumor cells expressing PXDN (A–C) Murine PyMT tumor single cell data (11,490 cells) obtained from Valdés-Mora et al. (A) UMAP of the major cell types identified in the murine single cell data. (B) UMAP of PXDN expression across cells. (C) Violin plots of fold change in PXDN expression according to cell type in the murine dataset. (D and E) Human breast cancer single cell and spatial data containing 130,246 cells from 26 invasive breast cancer patients. (D) UMAP of the major cell types identified in the human single cell data. (E) UMAP of PXDN expression across human cells. (F) Boxplots of fold change in PXDN expression according to cell type in the human dataset.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Single-cell Analysis, Expressing, Single Cell

    PXDN affects cell proliferation and spheroid formation dynamics in CAFs Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are shown on each graph. p values <0.05 were considered significant. ns = not significant. (A and C) RNA expression of PXDN in shScr and sh#1 (A), or WT and OE (C) CAFs. Error bars show the standard deviation of six independent experiments. (B and D) Representative western blots showing PXDN levels in conditioned media (top) from shScr and sh#1 CAFs (B) or WT and OE CAFs (D), with densitometry quantification of three biological replicate western blots (bottom). Densitometry measurements were normalized to total protein loading (measured by Ponceau S stain) and calculated relative to control (shScr or WT) protein expression. (E and F) 2D proliferation of shScr and sh#1 CAFs (E) or WT and OE CAFs (F) as measured by Alamar blue assay five days of culture (left). Differences between CAF lines were directly compared on day 5 (right). Error bars indicate the standard error of the mean for three biological replicates. (G–L) 3D growth of shScr (blue), sh#1 (red), WT (purple), and OE (gold) CAFs as spheroids over the course of 16 days. (G and I) Spheroid area and (K and L) representative images over the course of 16 days. Scale bars, 400 μm. Dotted lines indicate media changes on days 4, 8, and 12. Error bars indicate the standard error of the mean for three biological replicates. (H and J) The day of spheroid growth at which spheroids reached their smallest size before expanding. Error bars indicate the standard error of 24 spheroids across three biological replicates.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: PXDN affects cell proliferation and spheroid formation dynamics in CAFs Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are shown on each graph. p values <0.05 were considered significant. ns = not significant. (A and C) RNA expression of PXDN in shScr and sh#1 (A), or WT and OE (C) CAFs. Error bars show the standard deviation of six independent experiments. (B and D) Representative western blots showing PXDN levels in conditioned media (top) from shScr and sh#1 CAFs (B) or WT and OE CAFs (D), with densitometry quantification of three biological replicate western blots (bottom). Densitometry measurements were normalized to total protein loading (measured by Ponceau S stain) and calculated relative to control (shScr or WT) protein expression. (E and F) 2D proliferation of shScr and sh#1 CAFs (E) or WT and OE CAFs (F) as measured by Alamar blue assay five days of culture (left). Differences between CAF lines were directly compared on day 5 (right). Error bars indicate the standard error of the mean for three biological replicates. (G–L) 3D growth of shScr (blue), sh#1 (red), WT (purple), and OE (gold) CAFs as spheroids over the course of 16 days. (G and I) Spheroid area and (K and L) representative images over the course of 16 days. Scale bars, 400 μm. Dotted lines indicate media changes on days 4, 8, and 12. Error bars indicate the standard error of the mean for three biological replicates. (H and J) The day of spheroid growth at which spheroids reached their smallest size before expanding. Error bars indicate the standard error of 24 spheroids across three biological replicates.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: RNA Expression, Standard Deviation, Western Blot, Staining, Control, Expressing, Alamar Blue Assay

    PXDN inhibits the ability of CAFs to remodel collagen matrices (A and C) Representative images of collagen matrices contraction over the course of 12 days when seeded with shScr or sh#1 CAFs (A) or WT or OE CAFs (C). Scale bars, 1 cm. (B and D) Area of matrices during contraction over the course of 12 days (left), with differences in final area of matrices compared at day 12 (right). Error bars indicate the standard error of the mean for three biological replicates. p values were calculated using Student’s t tests. p values <0.05 were considered significant.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: PXDN inhibits the ability of CAFs to remodel collagen matrices (A and C) Representative images of collagen matrices contraction over the course of 12 days when seeded with shScr or sh#1 CAFs (A) or WT or OE CAFs (C). Scale bars, 1 cm. (B and D) Area of matrices during contraction over the course of 12 days (left), with differences in final area of matrices compared at day 12 (right). Error bars indicate the standard error of the mean for three biological replicates. p values were calculated using Student’s t tests. p values <0.05 were considered significant.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques:

    Impact of CAF-produced PXDN on cancer cell proliferation and motility Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are indicated on each graph. p values <0.05 were considered significant. ns = not significant. (A) Schematic of generation of CAF-generated CDMs, onto which cancer cells were seeded. (B and C) Proliferation rates of cancer cells seeded on CDMs produced by sh#1 or shScr CAFs (B), or by WT and OE CAFs (C) as measured by Alamar blue at day 7. Error bars represent the standard deviation of eight replicates. (D and F) Mean velocity of cancer cells when seeded onto CDMs produced by shScr or sh#1 CAFs (D) or by WT or OE CAFs (F). (E and G) Distance traveled by cancer cells when seeded onto CDMs produced by shScr or sh#1 CAFs (E) or by WT or OE CAFs (G). A minimum of ten cells were tracked per biological replicate, across three biological replicates. Error bars indicate the standard deviation.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Impact of CAF-produced PXDN on cancer cell proliferation and motility Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are indicated on each graph. p values <0.05 were considered significant. ns = not significant. (A) Schematic of generation of CAF-generated CDMs, onto which cancer cells were seeded. (B and C) Proliferation rates of cancer cells seeded on CDMs produced by sh#1 or shScr CAFs (B), or by WT and OE CAFs (C) as measured by Alamar blue at day 7. Error bars represent the standard deviation of eight replicates. (D and F) Mean velocity of cancer cells when seeded onto CDMs produced by shScr or sh#1 CAFs (D) or by WT or OE CAFs (F). (E and G) Distance traveled by cancer cells when seeded onto CDMs produced by shScr or sh#1 CAFs (E) or by WT or OE CAFs (G). A minimum of ten cells were tracked per biological replicate, across three biological replicates. Error bars indicate the standard deviation.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Produced, Generated, Standard Deviation

    Effect of CAF PXDN expression on breast tumor progression in vivo Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are indicated on each graph. p values <0.05 were considered significant; ns = not significant. (A and B) Latency of tumor formation from the time cells were implanted into mice along with shScr or sh#1 CAFs (A) or with WT or OE CAFs (B) until tumors reached 50 mm 3 in size. (C and D) Final weights of tumors upon collection from mice implanted with cancer cells and shScr or sh#1 CAFs (C) or with WT or OE CAFs (D). (E) Representative images of α-SMA staining in tumors from shScr or sh#1 CAF tumors. Scale bars, 100 μm. (F) Quantification of α-SMA staining in shScr and sh#1 CAF tumors. Error bars indicate the standard deviation. (G) Representative images of α-SMA staining in tumors from WT or OE CAF tumors. Scale bars, 100 μm. (H) Quantification of α-SMA staining in WT and OE CAF tumors. Error bars indicate the standard deviation.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Effect of CAF PXDN expression on breast tumor progression in vivo Differences between shScr CAFs and sh#1 CAFs, or between WT CAFs and OE CAFs, were calculated using Student’s t tests and p values are indicated on each graph. p values <0.05 were considered significant; ns = not significant. (A and B) Latency of tumor formation from the time cells were implanted into mice along with shScr or sh#1 CAFs (A) or with WT or OE CAFs (B) until tumors reached 50 mm 3 in size. (C and D) Final weights of tumors upon collection from mice implanted with cancer cells and shScr or sh#1 CAFs (C) or with WT or OE CAFs (D). (E) Representative images of α-SMA staining in tumors from shScr or sh#1 CAF tumors. Scale bars, 100 μm. (F) Quantification of α-SMA staining in shScr and sh#1 CAF tumors. Error bars indicate the standard deviation. (G) Representative images of α-SMA staining in tumors from WT or OE CAF tumors. Scale bars, 100 μm. (H) Quantification of α-SMA staining in WT and OE CAF tumors. Error bars indicate the standard deviation.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Expressing, In Vivo, Staining, Standard Deviation

    Effect of PXDN inhibition on breast tumor progression using AZD5904 (A) Inhibition of PXDN by a range of concentrations of AZD5904 measured on live cells using a modified Amplex red activity assay. Resorufin fluorescence was monitored continuously for 1 h. Error bars indicate standard error of the mean across three biological replicates, each consisting of eight technical replicates. (B) Final resorufin fluorescence readings at 60 min were used to determine to IC50 inhibitory concentration of AZD5904. (C) Kaplan-Meier curve of mouse survival measured from the start of treatment with AZD5904 or vehicle (when tumors reached a detectable size of 50 mm 3 ) until tumors reached a maximum ethical size of 1 cm by 1 cm and mice were sacrificed. Survival curves were significantly different, with a log-rank p value of 0.0088. (D) Final weights of tumors upon collection from mice in the AZD5904 in vivo study. Error bars indicate the standard deviation. Student’s t test showed no statistical significance between vehicle and AZD5904 treatment groups. (E) Time taken for tumors to reach the detectable size of 50 mm 3 at which point treatment started. Error bars indicate the standard deviation. Student’s t test showed no statistical significance between vehicle and AZD5904 treatment groups.

    Journal: iScience

    Article Title: Stromal peroxidasin drives early tumor growth in breast cancer

    doi: 10.1016/j.isci.2026.116078

    Figure Lengend Snippet: Effect of PXDN inhibition on breast tumor progression using AZD5904 (A) Inhibition of PXDN by a range of concentrations of AZD5904 measured on live cells using a modified Amplex red activity assay. Resorufin fluorescence was monitored continuously for 1 h. Error bars indicate standard error of the mean across three biological replicates, each consisting of eight technical replicates. (B) Final resorufin fluorescence readings at 60 min were used to determine to IC50 inhibitory concentration of AZD5904. (C) Kaplan-Meier curve of mouse survival measured from the start of treatment with AZD5904 or vehicle (when tumors reached a detectable size of 50 mm 3 ) until tumors reached a maximum ethical size of 1 cm by 1 cm and mice were sacrificed. Survival curves were significantly different, with a log-rank p value of 0.0088. (D) Final weights of tumors upon collection from mice in the AZD5904 in vivo study. Error bars indicate the standard deviation. Student’s t test showed no statistical significance between vehicle and AZD5904 treatment groups. (E) Time taken for tumors to reach the detectable size of 50 mm 3 at which point treatment started. Error bars indicate the standard deviation. Student’s t test showed no statistical significance between vehicle and AZD5904 treatment groups.

    Article Snippet: Lentiviral PXDN shRNA knockdown constructs and a Scrambled control construct containing GFP sequences were obtained from OriGene (TL513178V).

    Techniques: Inhibition, Modification, Activity Assay, Fluorescence, Concentration Assay, In Vivo, Standard Deviation